Antibodies
Anti-EBP1 Antibody-Oligo Conjugate
SKU: aoc1938
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EBP1 Antibody-IF1
Antibody Target
- Target
- Proliferation-associated protein 2G4
- UniProt Number
- Q9UQ80
- Target Description
- May play a role in a ERBB3-regulated signal transduction pathway. Seems be involved in growth regulation. Acts a corepressor of the androgen receptor (AR) and is regulated by the ERBB3 ligand neuregulin-1/heregulin (HRG). Inhibits transcription of some E2F1-regulated promoters, probably by recruiting histone acetylase (HAT) activity. Binds RNA. Associates with 28S, 18S and 5.8S mature rRNAs, several rRNA precursors and probably U3 small nucleolar RNA. May be involved in regulation of intermediate and late steps of rRNA processing. May be involved in ribosome assembly. Mediates cap-independent translation of specific viral IRESs (internal ribosomal entry site). Regulates cell proliferation, differentiation, and survival. Isoform 1 suppresses apoptosis whereas isoform 2 promotes cell differentiation.
- Molecular Weight
- 44kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1281
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat