Antibodies
Anti-ECHS1 Antibody-Oligo Conjugate
SKU: aoc1940
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ECHS1 Antibody-IF1
Antibody Target
- Target
- Enoyl-CoA hydratase, mitochondrial
- UniProt Number
- P30084
- Target Description
- Converts unsaturated trans-2-enoyl-CoA species ((2E)-enoyl-CoA) to the corresponding (3S)-3hydroxyacyl-CoA species through addition of a water molecule to the double bond (PubMed:25125611, PubMed:26251176). Catalyzes the hydration of medium- and short-chained fatty enoyl-CoA thioesters from 4 carbons long (C4) up to C16 (PubMed:26251176). Has high substrate specificity for crotonyl-CoA ((2E)-butenoyl-CoA) and moderate specificity for acryloyl-CoA, 3-methylcrotonyl-CoA (3-methyl-(2E)-butenoyl-CoA) and methacrylyl-CoA ((2E)-2-methylpropenoyl-CoA) (PubMed:26251176). Can bind tiglyl-CoA (2-methylcrotonoyl-CoA), but hydrates only a small amount of this substrate (PubMed:26251176). Plays a key role in the beta-oxidation spiral of short- and medium-chain fatty acid oxidation (PubMed:25125611, PubMed:26251176). At a lower rate than the hydratase reaction, catalyzes the isomerase reaction of trans-3-enoyl-CoA species (such as (3E)-hexenoyl-CoA) to trans-2-enoyl-CoA species (such as (2E)-hexenoyl-CoA), which are subsequently hydrated to 3(S)-3-hydroxyacyl-CoA species (such as (3S)-hydroxyhexanoyl-CoA) (By similarity)..
- Molecular Weight
- 31kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC68644
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat