Antibodies
Anti-eEF1A1 Antibody-Oligo Conjugate
SKU: aoc1943
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-eEF1A1 Antibody-IF1
Antibody Target
- Target
- Elongation factor 1-alpha 1
- UniProt Number
- P68104
- Target Description
- Translation elongation factor that catalyzes the GTP-dependent binding of aminoacyl-tRNA (aa-tRNA) to the A-site of ribosomes during the elongation phase of protein synthesis (PubMed:26593721, PubMed:26651998, PubMed:36123449, PubMed:36264623, PubMed:36638793). Base pairing between the mRNA codon and the aa-tRNA anticodon promotes GTP hydrolysis, releasing the aa-tRNA from EEF1A1 and allowing its accommodation into the ribosome (PubMed:26593721, PubMed:26651998, PubMed:36123449, PubMed:36264623, PubMed:36638793). The growing protein chain is subsequently transferred from the P-site peptidyl tRNA to the A-site aa-tRNA, extending it by one amino acid through ribosome-catalyzed peptide bond formation (PubMed:26593721, PubMed:26651998, PubMed:36123449, PubMed:36264623). Also plays a role in the positive regulation of IFNG transcription in T-helper 1 cells as part of an IFNG promoter-binding complex with TXK and PARP1 (PubMed:17177976). Also plays a role in cytoskeleton organization by promoting actin bundling (By similarity)..; FUNCTION: (Microbial infection) Required for the translation of viral proteins and viral replication during human coronavirus SARS-CoV-2 infection..
- Molecular Weight
- 50kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC55875
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat