Antibodies
Anti-EGFR Antibody-Oligo Conjugate (ARC1139)
SKU: aoc1951
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EGFR Antibody (ARC1139)-IF1
Antibody Target
- Target
- Epidermal growth factor receptor
- UniProt Number
- P00533
- Target Description
- Receptor tyrosine kinase binding ligands of the EGF family and activating several signaling cascades to convert extracellular cues into appropriate cellular responses (PubMed:10805725, PubMed:27153536, PubMed:2790960, PubMed:35538033). Known ligands include EGF, TGFA/TGF-alpha, AREG, epigen/EPGN, BTC/betacellulin, epiregulin/EREG and HBEGF/heparin-binding EGF (PubMed:12297049, PubMed:15611079, PubMed:17909029, PubMed:20837704, PubMed:27153536, PubMed:2790960, PubMed:7679104, PubMed:8144591, PubMed:9419975). Ligand binding triggers receptor homo- and/or heterodimerization and autophosphorylation on key cytoplasmic residues. The phosphorylated receptor recruits adapter proteins like GRB2 which in turn activates complex downstream signaling cascades. Activates at least 4 major downstream signaling cascades including the RAS-RAF-MEK-ERK, PI3 kinase-AKT, PLCgamma-PKC and STATs modules (PubMed:27153536). May also activate the NF-kappa-B signaling cascade (PubMed:11116146). Also directly phosphorylates other proteins like RGS16, activating its GTPase activity and probably coupling the EGF receptor signaling to the G protein-coupled receptor signaling (PubMed:11602604). Also phosphorylates MUC1 and increases its interaction with SRC and CTNNB1/beta-catenin (PubMed:11483589). Positively regulates cell migration via interaction with CCDC88A/GIV which retains EGFR at the cell membrane following ligand stimulation, promoting EGFR signaling which triggers cell migration (PubMed:20462955). Plays a role in enhancing learning and memory performance (By similarity). Plays a role in mammalian pain signaling (long-lasting hypersensitivity) (By similarity)..; FUNCTION: Isoform 2 may act as an antagonist of EGF action.; FUNCTION: (Microbial infection) Acts as a receptor for hepatitis C virus (HCV) in hepatocytes and facilitates its cell entry. Mediates HCV entry by promoting the formation of the CD81-CLDN1 receptor complexes that are essential for HCV entry and by enhancing membrane fusion of cells expressing HCV envelope glycoproteins..
- Molecular Weight
- 134kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1139
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse