Antibodies
Anti-EGR2 Antibody-Oligo Conjugate
SKU: aoc1952
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-EGR2 Antibody-PLA1
Antibody Target
- Target
- E3 SUMO-protein ligase EGR2
- UniProt Number
- P11161
- Target Description
- Sequence-specific DNA-binding transcription factor (PubMed:17717711). Plays a role in hindbrain segmentation by regulating the expression of a subset of homeobox containing genes and in Schwann cell myelination by regulating the expression of genes involved in the formation and maintenance of myelin (By similarity). Binds to two EGR2-consensus sites EGR2A (5'-CTGTAGGAG-3') and EGR2B (5'-ATGTAGGTG-3') in the HOXB3 enhancer and promotes HOXB3 transcriptional activation (By similarity). Binds to specific DNA sites located in the promoter region of HOXA4, HOXB2 and ERBB2 (By similarity). Regulates hindbrain segmentation by controlling the expression of Hox genes, such as HOXA4, HOXB3 and HOXB2, and thereby specifying odd and even rhombomeres (By similarity). Promotes the expression of HOXB3 in the rhombomere r5 in the hindbrain (By similarity). Regulates myelination in the peripheral nervous system after birth, possibly by regulating the expression of myelin proteins, such as MPZ, and by promoting the differentiation of Schwann cells (By similarity). Involved in the development of the jaw openener musculature, probably by playing a role in its innervation through trigeminal motor neurons (By similarity). May play a role in adipogenesis, possibly by regulating the expression of CEBPB (By similarity)..; FUNCTION: E3 SUMO-protein ligase helping SUMO1 conjugation to its coregulators NAB1 and NAB2, whose sumoylation down-regulates EGR2 transcriptional activity..
- Molecular Weight
- 50kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC1932
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat