Antibodies
Anti-EHD1 Antibody-Oligo Conjugate
SKU: aoc1953
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EHD1 Antibody-IF1
Antibody Target
- Target
- EH domain-containing protein 1
- UniProt Number
- Q9H4M9
- Target Description
- ATP- and membrane-binding protein that controls membrane reorganization/tubulation upon ATP hydrolysis. In vitro causes vesiculation of endocytic membranes (PubMed:24019528). Acts in early endocytic membrane fusion and membrane trafficking of recycling endosomes (PubMed:15020713, PubMed:17233914, PubMed:20801876). Recruited to endosomal membranes upon nerve growth factor stimulation, indirectly regulates neurite outgrowth (By similarity). Plays a role in myoblast fusion (By similarity). Involved in the unidirectional retrograde dendritic transport of endocytosed BACE1 and in efficient sorting of BACE1 to axons implicating a function in neuronal APP processing (By similarity). Plays a role in the formation of the ciliary vesicle (CV), an early step in cilium biogenesis (PubMed:31615969). Proposed to be required for the fusion of distal appendage vesicles (DAVs) to form the CV by recruiting SNARE complex component SNAP29. Is required for recruitment of transition zone proteins CEP290, RPGRIP1L, TMEM67 and B9D2, and of IFT20 following DAV reorganization before Rab8-dependent ciliary membrane extension. Required for the loss of CCP110 form the mother centriole essential for the maturation of the basal body during ciliogenesis (PubMed:25686250)..
- Molecular Weight
- 61kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2015
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat