Antibodies
Anti-EHHADH Antibody-Oligo Conjugate
SKU: aoc1955
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EHHADH Antibody-IF1
Antibody Target
- Target
- Peroxisomal bifunctional enzyme
- UniProt Number
- Q08426
- Target Description
- Peroxisomal trifunctional enzyme possessing 2-enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydrogenase, and delta 3, delta 2-enoyl-CoA isomerase activities. Catalyzes two of the four reactions of the long chain fatty acids peroxisomal beta-oxidation pathway. Can also use branched-chain fatty acids such as 2-methyl-2E-butenoyl-CoA as a substrate, which is hydrated into (2S,3S)-3-hydroxy-2-methylbutanoyl-CoA. Optimal isomerase for 2,5 double bonds into 3,5 form isomerization in a range of enoyl-CoA species (Probable). Also able to isomerize both 3-cis and 3-trans double bonds into the 2-trans form in a range of enoyl-CoA species. With HSD17B4, catalyzes the hydration of trans-2-enoyl-CoA and the dehydrogenation of 3-hydroxyacyl-CoA, but with opposite chiral specificity. Regulates the amount of medium-chain dicarboxylic fatty acids which are essential regulators of all fatty acid oxidation pathways. Also involved in the degradation of long-chain dicarboxylic acids through peroxisomal beta-oxidation.
- Molecular Weight
- 79kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC72735
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat