Antibodies
Anti-EHMT2/G9A Antibody-Oligo Conjugate
SKU: aoc1956
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EHMT2/G9A Antibody-IF1
Antibody Target
- Target
- Histone-lysine N-methyltransferase EHMT2
- UniProt Number
- Q96KQ7
- Target Description
- Histone methyltransferase that specifically mono- and dimethylates 'Lys-9' of histone H3 (H3K9me1 and H3K9me2, respectively) in euchromatin. H3K9me represents a specific tag for epigenetic transcriptional repression by recruiting HP1 proteins to methylated histones. Also mediates monomethylation of 'Lys-56' of histone H3 (H3K56me1) in G1 phase, leading to promote interaction between histone H3 and PCNA and regulating DNA replication. Also weakly methylates 'Lys-27' of histone H3 (H3K27me). Also required for DNA methylation, the histone methyltransferase activity is not required for DNA methylation, suggesting that these 2 activities function independently. Probably targeted to histone H3 by different DNA-binding proteins like E2F6, MGA, MAX and/or DP1. May also methylate histone H1. In addition to the histone methyltransferase activity, also methylates non-histone proteins: mediates dimethylation of 'Lys-373' of p53/TP53. Also methylates CDYL, WIZ, ACIN1, DNMT1, HDAC1, ERCC6, KLF12 and itself..
- Molecular Weight
- 132 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2470
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat