Antibodies
Anti-eIF2B epsilon (EIF2B5) Antibody-Oligo Conjugate
SKU: aoc1959
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-eIF2B epsilon (EIF2B5) Antibody-IF1
Antibody Target
- Target
- Translation initiation factor eIF2B subunit epsilon
- UniProt Number
- Q13144
- Target Description
- Acts as a component of the translation initiation factor 2B (eIF2B) complex, which catalyzes the exchange of GDP for GTP on eukaryotic initiation factor 2 (eIF2) gamma subunit (PubMed:25858979, PubMed:27023709, PubMed:31048492). Its guanine nucleotide exchange factor activity is repressed when bound to eIF2 complex phosphorylated on the alpha subunit, thereby limiting the amount of methionyl-initiator methionine tRNA available to the ribosome and consequently global translation is repressed (PubMed:25858979, PubMed:31048492)..
- Molecular Weight
- 80kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1774
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human