Antibodies
Anti-EIF4E Antibody-Oligo Conjugate
SKU: aoc1966
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EIF4E Antibody-IF1
Antibody Target
- Target
- Eukaryotic translation initiation factor 4E
- UniProt Number
- P06730
- Target Description
- Acts in the cytoplasm to initiate and regulate protein synthesis and is required in the nucleus for export of a subset of mRNAs from the nucleus to the cytoplasm which promotes processes such as RNA capping, processing and splicing (PubMed:11606200, PubMed:22578813, PubMed:22684010, PubMed:24335285, PubMed:29987188). Component of the protein complex eIF4F, which is involved in the recognition of the mRNA cap, ATP-dependent unwinding of 5'-terminal secondary structure and recruitment of mRNA to the ribosome (By similarity). This protein recognizes and binds the 7-methylguanosine (m7G)-containing mRNA cap during an early step in the initiation of protein synthesis and facilitates ribosome binding by inducing the unwinding of the mRNAs secondary structures (PubMed:16271312, PubMed:22578813). Together with EIF4G1, antagonizes the scanning promoted by EIF1-EIF4G1 and is required for TISU translation, a process where the TISU element recognition makes scanning unnecessary (PubMed:29987188). In addition to its role in translation initiation, also acts as a regulator of translation and stability in the cytoplasm (PubMed:24335285). Component of the CYFIP1-EIF4E-FMR1 complex which binds to the mRNA cap and mediates translational repression: in the complex, EIF4E mediates the binding to the mRNA cap (By similarity). Component of a multiprotein complex that sequesters and represses translation of proneurogenic factors during neurogenesis (By similarity). In P-bodies, component of a complex that mediates the storage of translationally inactive mRNAs in the cytoplasm and prevents their degradation (PubMed:24335285). May play an important role in spermatogenesis through translational regulation of stage-specific mRNAs during germ cell development (By similarity). As well as its roles in translation, also involved in mRNA nucleocytoplasmic transport (By similarity). Its role in mRNA export from the nucleus to the cytoplasm relies on its ability to bind the m7G cap of RNAs and on the presence of the 50-nucleotide EIF4E sensitivity element (4ESE) in the 3'UTR of sensitive transcripts (By similarity). Interaction with the 4ESE is mediated by LRPPRC which binds simultaneously to both EIF4E and the 4ESE, thereby acting as a platform for assembly for the RNA export complex (By similarity). EIF4E-dependent mRNA export is independent of ongoing protein or RNA synthesis and is also NFX1-independent but is XPO1-dependent with LRPPRC interacting with XPO1 to form an EIF4E-dependent mRNA export complex (By similarity). Alters the composition of the cytoplasmic face of the nuclear pore to promote RNA export by reducing RANBP2 expression, relocalizing nucleoporin NUP214 and increasing expression of RANBP1 and RNA export factors DDX19 and GLE1 (By similarity). Promotes the nuclear export of cyclin CCND1 mRNA (By similarity). Promotes the nuclear export of NOS2/iNOS mRNA (PubMed:23471078). Promotes the nuclear export of MDM2 mRNA (PubMed:22684010). Promotes the export of additional mRNAs, including others involved in the cell cycle (By similarity). In the nucleus, binds to capped splice factor-encoding mRNAs and stimulates their nuclear export to enhance splice factor production by increasing their cytoplasmic availability to the translation machinery (By similarity). May also regulate splicing through interaction with the spliceosome in an RNA and m7G cap-dependent manner (By similarity). Also binds to some pre-mRNAs and may play a role in their recruitment to the spliceosome (By similarity). Promotes steady-state capping of a subset of coding and non-coding RNAs by mediating nuclear export of capping machinery mRNAs including RNMT, RNGTT and RAMAC to enhance their translation (By similarity). Stimulates mRNA 3'-end processing by promoting the expression of several core cleavage complex factors required for mRNA cleavage and polyadenylation, and may also have a direct effect through its interaction with the CPSF3 cleavage enzyme (By similarity). Rescues cells from apoptosis by promoting activation of serine/threonine-protein kinase AKT1 through mRNA export of NBS1 which potentiates AKT1 phosphorylation and also through mRNA export of AKT1 effectors, allowing for increased production of these proteins (By similarity)..
- Molecular Weight
- 25kDa/27kDa/29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC66295
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRatMonkey