Antibodies
Anti-ELK1 Antibody-Oligo Conjugate
SKU: aoc1969
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-ELK1 Antibody-PLA1
Antibody Target
- Target
- ETS domain-containing protein Elk-1
- UniProt Number
- P19419
- Target Description
- Transcription factor that binds to purine-rich DNA sequences. Forms a ternary complex with SRF and the ETS and SRF motifs of the serum response element (SRE) on the promoter region of immediate early genes such as FOS and IER2. Induces target gene transcription upon JNK and MAPK-signaling pathways stimulation.
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0339
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat