Antibodies
Anti-ELK1 Antibody-Oligo Conjugate
SKU: aoc1969
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-ELK1 Antibody-PLA1
Antibody Target
- Target
- ETS domain-containing protein Elk-1
- UniProt Number
- P19419
- Target Description
- Transcription factor that binds to purine-rich DNA sequences (PubMed:10799319, PubMed:7889942). Forms a ternary complex with SRF and the ETS and SRF motifs of the serum response element (SRE) on the promoter region of immediate early genes such as FOS and IER2 (PubMed:1630903). Induces target gene transcription upon JNK and MAPK-signaling pathways stimulation (PubMed:7889942)..
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0339
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat