Antibodies
Anti-ELMO1 Antibody-Oligo Conjugate
SKU: aoc1970
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ELMO1 Antibody-IF1
Antibody Target
- Target
- Engulfment and cell motility protein 1
- UniProt Number
- Q92556
- Target Description
- Involved in cytoskeletal rearrangements required for phagocytosis of apoptotic cells and cell motility. Acts in association with DOCK1 and CRK. Was initially proposed to be required in complex with DOCK1 to activate Rac Rho small GTPases. May enhance the guanine nucleotide exchange factor (GEF) activity of DOCK1.
- Molecular Weight
- 84kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1985
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat