Antibodies
Anti-ELP3 Antibody-Oligo Conjugate
SKU: aoc1971
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ELP3 Antibody-IF1
Antibody Target
- Target
- Elongator complex protein 3
- UniProt Number
- Q9H9T3
- Target Description
- Catalytic tRNA acetyltransferase subunit of the elongator complex which is required for multiple tRNA modifications, including mcm5U (5-methoxycarbonylmethyl uridine), mcm5s2U (5-methoxycarbonylmethyl-2-thiouridine), and ncm5U (5-carbamoylmethyl uridine) (PubMed:29415125). In the elongator complex, acts as a tRNA uridine(34) acetyltransferase by mediating formation of carboxymethyluridine in the wobble base at position 34 in tRNAs (By similarity). May also act as a protein lysine acetyltransferase by mediating acetylation of target proteins; such activity is however unclear in vivo and recent evidences suggest that ELP3 primarily acts as a tRNA acetyltransferase (PubMed:29415125). Involved in neurogenesis: regulates the migration and branching of projection neurons in the developing cerebral cortex, through a process depending on alpha-tubulin acetylation (PubMed:19185337). Required for acetylation of GJA1 in the developing cerebral cortex (By similarity)..
- Molecular Weight
- 62kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1806
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat