Antibodies
Anti-EMC4 Antibody-Oligo Conjugate
SKU: aoc1972
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EMC4 Antibody-IF1
Antibody Target
- Target
- ER membrane protein complex subunit 4
- UniProt Number
- Q5J8M3
- Target Description
- Part of the endoplasmic reticulum membrane protein complex (EMC) that enables the energy-independent insertion into endoplasmic reticulum membranes of newly synthesized membrane proteins. Preferentially accommodates proteins with transmembrane domains that are weakly hydrophobic or contain destabilizing features such as charged and aromatic residues. Involved in the cotranslational insertion of multi-pass membrane proteins in which stop-transfer membrane-anchor sequences become ER membrane spanning helices. It is also required for the post-translational insertion of tail-anchored/TA proteins in endoplasmic reticulum membranes. By mediating the proper cotranslational insertion of N-terminal transmembrane domains in an N-exo topology, with translocated N-terminus in the lumen of the ER, controls the topology of multi-pass membrane proteins like the G protein-coupled receptors. By regulating the insertion of various proteins in membranes, it is indirectly involved in many cellular processes (Probable).
- Molecular Weight
- 15kDa/16kDa/20kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC3006
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat