Antibodies
Anti-EMC4 Antibody-Oligo Conjugate
SKU: aoc1972
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EMC4 Antibody-IF1
Antibody Target
- Target
- ER membrane protein complex subunit 4
- UniProt Number
- Q5J8M3
- Target Description
- Part of the endoplasmic reticulum membrane protein complex (EMC) that enables the energy-independent insertion into endoplasmic reticulum membranes of newly synthesized membrane proteins (PubMed:29242231, PubMed:29809151, PubMed:30415835, PubMed:32439656, PubMed:32459176). Preferentially accommodates proteins with transmembrane domains that are weakly hydrophobic or contain destabilizing features such as charged and aromatic residues (PubMed:29242231, PubMed:29809151, PubMed:30415835). Involved in the cotranslational insertion of multi-pass membrane proteins in which stop-transfer membrane-anchor sequences become ER membrane spanning helices (PubMed:29809151, PubMed:30415835). It is also required for the post-translational insertion of tail-anchored/TA proteins in endoplasmic reticulum membranes (PubMed:29242231, PubMed:29809151). By mediating the proper cotranslational insertion of N-terminal transmembrane domains in an N-exo topology, with translocated N-terminus in the lumen of the ER, controls the topology of multi-pass membrane proteins like the G protein-coupled receptors (PubMed:30415835). By regulating the insertion of various proteins in membranes, it is indirectly involved in many cellular processes (Probable)..
- Molecular Weight
- 15kDa/16kDa/20kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC3006
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat