Antibodies
Anti-Emerin Antibody-Oligo Conjugate
SKU: aoc1973
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Emerin Antibody-IF1
Antibody Target
- Target
- Emerin
- UniProt Number
- P50402
- Target Description
- Stabilizes and promotes the formation of a nuclear actin cortical network. Stimulates actin polymerization in vitro by binding and stabilizing the pointed end of growing filaments. Inhibits beta-catenin activity by preventing its accumulation in the nucleus. Acts by influencing the nuclear accumulation of beta-catenin through a CRM1-dependent export pathway. Links centrosomes to the nuclear envelope via a microtubule association. Required for proper localization of non-farnesylated prelamin-A/C. Together with NEMP1, contributes to nuclear envelope stiffness in germ cells. EMD and BAF are cooperative cofactors of HIV-1 infection. Association of EMD with the viral DNA requires the presence of BAF and viral integrase. The association of viral DNA with chromatin requires the presence of BAF and EMD.
- Molecular Weight
- 29 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0921
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat