Antibodies
Anti-ENPP3 Antibody-Oligo Conjugate
SKU: aoc1979
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ENPP3 Antibody-IF1
Antibody Target
- Target
- Ectonucleotide pyrophosphatase/phosphodiesterase family member 3
- UniProt Number
- O14638
- Target Description
- Hydrolase that metabolizes extracellular nucleotides, including ATP, GTP, UTP and CTP. Limits mast cells and basophils response during inflammation and during the chronic phases of allergic responses by eliminating extracellular ATP, a signaling molecule activating these cells in an autocrine manner. Metabolizes extracellular ATP in the lumen of the small intestine, and thereby prevents ATP-induced apoptosis of intestinal plasmacytoid dendritic cells. Has a broad specificity and can also hydrolyze UDP-GlcNAc into UMP and GlcNAc-1-phosphate and potentially several other intracellular nucleotide sugars, including UDP-GalNAc, CMP-NeuAc, GDP-Fuc, and UDP-GlcA. Thereby, could modulate glycan biosynthesis and protein glycosylation. Can hydrolyze extracellular dinucleoside polyphosphates, including the vasoactive adenosine polyphosphates as well. In addition, displays an alkaline phosphodiesterase activity in vitro.
- Molecular Weight
- 100kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCFlow CytometryELISA
- Clone
- ARC63726
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human