Antibodies
Anti-ENPP3 Antibody-Oligo Conjugate
SKU: aoc1979
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ENPP3 Antibody-IF1
Antibody Target
- Target
- Ectonucleotide pyrophosphatase/phosphodiesterase family member 3
- UniProt Number
- O14638
- Target Description
- Hydrolase that metabolizes extracellular nucleotides, including ATP, GTP, UTP and CTP (PubMed:29717535, PubMed:9344668). Limits mast cells and basophils response during inflammation and during the chronic phases of allergic responses by eliminating extracellular ATP, a signaling molecule activating these cells in an autocrine manner. Metabolizes extracellular ATP in the lumen of the small intestine, and thereby prevents ATP-induced apoptosis of intestinal plasmacytoid dendritic cells (By similarity). Has a broad specificity and can also hydrolyze UDP-GlcNAc into UMP and GlcNAc-1-phosphate and potentially several other intracellular nucleotide sugars, including UDP-GalNAc, CMP-NeuAc, GDP-Fuc, and UDP-GlcA. Thereby, could modulate glycan biosynthesis and protein glycosylation (By similarity). Can hydrolyze extracellular dinucleoside polyphosphates, including the vasoactive adenosine polyphosphates as well (PubMed:12846830). In addition, displays an alkaline phosphodiesterase activity in vitro (PubMed:11342463)..
- Molecular Weight
- 100kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCFlow CytometryELISA
- Clone
- ARC63726
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human