Antibodies
Anti-ENT2 Antibody-Oligo Conjugate
SKU: aoc1981
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ENT2 Antibody-IF1
Antibody Target
- Target
- Equilibrative nucleoside transporter 2
- UniProt Number
- Q14542
- Target Description
- Bidirectional uniporter involved in the facilitative transport of nucleosides and nucleobases, and contributes to maintaining their cellular homeostasis. Functions as a Na(+)-independent, passive transporter. Involved in the transport of nucleosides such as inosine, adenosine, uridine, thymidine, cytidine and guanosine. Also able to transport purine nucleobases (hypoxanthine, adenine, guanine) and pyrimidine nucleobases (thymine, uracil). Involved in nucleoside transport at basolateral membrane of kidney cells, allowing liver absorption of nucleoside metabolites. Mediates apical nucleoside uptake into Sertoli cells, thereby regulating the transport of nucleosides in testis across the blood-testis-barrier. Mediates both the influx and efflux of hypoxanthine in skeletal muscle microvascular endothelial cells to control the amount of intracellular hypoxanthine available for xanthine oxidase-mediated ROS production.; FUNCTION: [Isoform 3]: Non functional nucleoside transporter protein for adenosine or thymidine transport. Does not express on cell membrane.
- Molecular Weight
- 50kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCELISA
- Clone
- ARC2234
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat