Antibodies
Anti-ENT2 Antibody-Oligo Conjugate
SKU: aoc1981
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ENT2 Antibody-IF1
Antibody Target
- Target
- Equilibrative nucleoside transporter 2
- UniProt Number
- Q14542
- Target Description
- Bidirectional uniporter involved in the facilitative transport of nucleosides and nucleobases, and contributes to maintaining their cellular homeostasis (PubMed:10722669, PubMed:12527552, PubMed:12590919, PubMed:16214850, PubMed:21795683, PubMed:9396714, PubMed:9478986). Functions as a Na(+)-independent, passive transporter (PubMed:9478986). Involved in the transport of nucleosides such as inosine, adenosine, uridine, thymidine, cytidine and guanosine (PubMed:10722669, PubMed:12527552, PubMed:12590919, PubMed:16214850, PubMed:21795683, PubMed:9396714, PubMed:9478986). Also able to transport purine nucleobases (hypoxanthine, adenine, guanine) and pyrimidine nucleobases (thymine, uracil) (PubMed:16214850, PubMed:21795683). Involved in nucleoside transport at basolateral membrane of kidney cells, allowing liver absorption of nucleoside metabolites (PubMed:12527552). Mediates apical nucleoside uptake into Sertoli cells, thereby regulating the transport of nucleosides in testis across the blood-testis-barrier (PubMed:23639800). Mediates both the influx and efflux of hypoxanthine in skeletal muscle microvascular endothelial cells to control the amount of intracellular hypoxanthine available for xanthine oxidase-mediated ROS production (By similarity)..; FUNCTION: [Isoform 3]: Non functional nucleoside transporter protein for adenosine or thymidine transport. Does not express on cell membrane..
- Molecular Weight
- 50kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCELISA
- Clone
- ARC2234
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat