Antibodies
Anti-ENTPD5 Antibody-Oligo Conjugate (ARC2211)
SKU: aoc1983
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ENTPD5 Antibody (ARC2211)-IF1
Antibody Target
- Target
- Nucleoside diphosphate phosphatase ENTPD5
- UniProt Number
- O75356
- Target Description
- Hydrolyzes nucleoside diphosphates with a preference for GDP, IDP and UDP compared to ADP and CDP. In the lumen of the endoplasmic reticulum, hydrolyzes UDP that acts as an end-product feedback inhibitor of the UDP-Glc:glycoprotein glucosyltransferases. UMP can be transported back by an UDP-sugar antiporter to the cytosol where it is consumed to regenerate UDP-glucose. Therefore, it positively regulates protein reglucosylation by clearing UDP from the ER lumen and by promoting the regeneration of UDP-glucose. Protein reglucosylation is essential to proper glycoprotein folding and quality control in the ER.
- Molecular Weight
- 48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2211
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat