Antibodies
Anti-EPAC1 Antibody-Oligo Conjugate
SKU: aoc1984
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EPAC1 Antibody-IF1
Antibody Target
- Target
- Rap guanine nucleotide exchange factor 3
- UniProt Number
- O95398
- Target Description
- Guanine nucleotide exchange factor (GEF) for RAP1A and RAP2A small GTPases that is activated by binding cAMP. Through simultaneous binding of PDE3B to RAPGEF3 and PIK3R6 is assembled in a signaling complex in which it activates the PI3K gamma complex and which is involved in angiogenesis. Plays a role in the modulation of the cAMP-induced dynamic control of endothelial barrier function through a pathway that is independent on Rho-mediated signaling. Required for the actin rearrangement at cell-cell junctions, such as stress fibers and junctional actin..
- Molecular Weight
- 104kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0908
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat