Antibodies
Anti-Ephrin B2 Antibody-Oligo Conjugate
SKU: aoc1993
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Ephrin B2 Antibody-IF1
Antibody Target
- Target
- Ephrin-B2
- UniProt Number
- P52799
- Target Description
- Cell surface transmembrane ligand for Eph receptors, a family of receptor tyrosine kinases which are crucial for migration, repulsion and adhesion during neuronal, vascular and epithelial development. Binds promiscuously Eph receptors residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. Binds to receptor tyrosine kinase including EPHA4, EPHA3 and EPHB4. Together with EPHB4 plays a central role in heart morphogenesis and angiogenesis through regulation of cell adhesion and cell migration. EPHB4-mediated forward signaling controls cellular repulsion and segregation from EFNB2-expressing cells. May play a role in constraining the orientation of longitudinally projecting axons..; FUNCTION: (Microbial infection) Acts as a receptor for Hendra virus and Nipah virus..
- Molecular Weight
- 37kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0576
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat