Antibodies

Anti-ERK2 Antibody-Oligo Conjugate

SKU: aoc2001

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-ERK2 Antibody-IF1

Antibody Target

Target
Mitogen-activated protein kinase 1
UniProt Number
P28482
Target Description
Serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction pathway. MAPK1/ERK2 and MAPK3/ERK1 are the 2 MAPKs which play an important role in the MAPK/ERK cascade. They participate also in a signaling cascade initiated by activated KIT and KITLG/SCF. Depending on the cellular context, the MAPK/ERK cascade mediates diverse biological functions such as cell growth, adhesion, survival and differentiation through the regulation of transcription, translation, cytoskeletal rearrangements. The MAPK/ERK cascade also plays a role in initiation and regulation of meiosis, mitosis, and postmitotic functions in differentiated cells by phosphorylating a number of transcription factors. About 160 substrates have already been discovered for ERKs. Many of these substrates are localized in the nucleus, and seem to participate in the regulation of transcription upon stimulation. However, other substrates are found in the cytosol as well as in other cellular organelles, and those are responsible for processes such as translation, mitosis and apoptosis. Moreover, the MAPK/ERK cascade is also involved in the regulation of the endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC); as well as in the fragmentation of the Golgi apparatus during mitosis. The substrates include transcription factors (such as ATF2, BCL6, ELK1, ERF, FOS, HSF4 or SPZ1), cytoskeletal elements (such as CANX, CTTN, GJA1, MAP2, MAPT, PXN, SORBS3 or STMN1), regulators of apoptosis (such as BAD, BTG2, CASP9, DAPK1, IER3, MCL1 or PPARG), regulators of translation (such as EIF4EBP1 and FXR1) and a variety of other signaling-related molecules (like ARHGEF2, DCC, FRS2 or GRB10). Protein kinases (such as RAF1, RPS6KA1/RSK1, RPS6KA3/RSK2, RPS6KA2/RSK3, RPS6KA6/RSK4, SYK, MKNK1/MNK1, MKNK2/MNK2, RPS6KA5/MSK1, RPS6KA4/MSK2, MAPKAPK3 or MAPKAPK5) and phosphatases (such as DUSP1, DUSP4, DUSP6 or DUSP16) are other substrates which enable the propagation the MAPK/ERK signal to additional cytosolic and nuclear targets, thereby extending the specificity of the cascade. Mediates phosphorylation of TPR in response to EGF stimulation. May play a role in the spindle assembly checkpoint. Phosphorylates PML and promotes its interaction with PIN1, leading to PML degradation. Phosphorylates CDK2AP2 (By similarity). Phosphorylates phosphoglycerate kinase PGK1 under hypoxic conditions to promote its targeting to the mitochondrion and suppress the formation of acetyl-coenzyme A from pyruvate (PubMed:26942675)..; FUNCTION: Acts as a transcriptional repressor. Binds to a [GC]AAA[GC] consensus sequence. Repress the expression of interferon gamma-induced genes. Seems to bind to the promoter of CCL5, DMP1, IFIH1, IFITM1, IRF7, IRF9, LAMP3, OAS1, OAS2, OAS3 and STAT1. Transcriptional activity is independent of kinase activity..
Molecular Weight
41 kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC51159
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat
Back to Product Catalog