Antibodies
Anti-Erlin-2 Antibody-Oligo Conjugate
SKU: aoc2003
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Erlin-2 Antibody-IF1
Antibody Target
- Target
- Erlin-2
- UniProt Number
- O94905
- Target Description
- Component of the ERLIN1/ERLIN2 complex which mediates the endoplasmic reticulum-associated degradation (ERAD) of inositol 1,4,5-trisphosphate receptors (IP3Rs) such as ITPR1 (PubMed:17502376, PubMed:19240031). Promotes sterol-accelerated ERAD of HMGCR probably implicating an AMFR/gp78-containing ubiquitin ligase complex (PubMed:21343306). Involved in regulation of cellular cholesterol homeostasis by regulation the SREBP signaling pathway. May promote ER retention of the SCAP-SREBF complex (PubMed:24217618)..
- Molecular Weight
- 38kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2538
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat