Antibodies
Anti-ERp57 Antibody-Oligo Conjugate
SKU: aoc2006
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ERp57 Antibody-IF1
Antibody Target
- Target
- Protein disulfide-isomerase A3
- UniProt Number
- P30101
- Target Description
- Protein disulfide isomerase that catalyzes the formation, isomerization, and reduction or oxidation of disulfide bonds in client proteins and functions as a protein folding chaperone (PubMed:11825568, PubMed:16193070, PubMed:27897272, PubMed:36104323, PubMed:7487104). Core component of the major histocompatibility complex class I (MHC I) peptide loading complex where it functions as an essential folding chaperone for TAPBP. Through TAPBP, assists the dynamic assembly of the MHC I complex with high affinity antigens in the endoplasmic reticulum. Therefore, plays a crucial role in the presentation of antigens to cytotoxic T cells in adaptive immunity (PubMed:35948544, PubMed:36104323)..
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0987
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human