Antibodies
Anti-Estrogen Receptor Antibody-Oligo Conjugate (ARC61898)
SKU: aoc2010
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Estrogen Receptor Antibody (ARC61898)-PLA1
Antibody Target
- Target
- Estrogen receptor
- UniProt Number
- P03372
- Target Description
- Nuclear hormone receptor. The steroid hormones and their receptors are involved in the regulation of eukaryotic gene expression and affect cellular proliferation and differentiation in target tissues. Ligand-dependent nuclear transactivation involves either direct homodimer binding to a palindromic estrogen response element (ERE) sequence or association with other DNA-binding transcription factors, such as AP-1/c-Jun, c-Fos, ATF-2, Sp1 and Sp3, to mediate ERE-independent signaling. Ligand binding induces a conformational change allowing subsequent or combinatorial association with multiprotein coactivator complexes through LXXLL motifs of their respective components. Mutual transrepression occurs between the estrogen receptor (ER) and NF-kappa-B in a cell-type specific manner. Decreases NF-kappa-B DNA-binding activity and inhibits NF-kappa-B-mediated transcription from the IL6 promoter and displace RELA/p65 and associated coregulators from the promoter. Recruited to the NF-kappa-B response element of the CCL2 and IL8 promoters and can displace CREBBP. Present with NF-kappa-B components RELA/p65 and NFKB1/p50 on ERE sequences. Can also act synergistically with NF-kappa-B to activate transcription involving respective recruitment adjacent response elements; the function involves CREBBP. Can activate the transcriptional activity of TFF1. Also mediates membrane-initiated estrogen signaling involving various kinase cascades. Essential for MTA1-mediated transcriptional regulation of BRCA1 and BCAS3. Maintains neuronal survival in response to ischemic reperfusion injury when in the presence of circulating estradiol (17-beta-estradiol/E2).; FUNCTION: [Isoform 3]: Involved in activation of NOS3 and endothelial nitric oxide production. Isoforms lacking one or several functional domains are thought to modulate transcriptional activity by competitive ligand or DNA binding and/or heterodimerization with the full-length receptor. Binds to ERE and inhibits isoform 1.
- Molecular Weight
- 66kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISAChIPFC (intra)
- Clone
- ARC61898
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human