Antibodies
Anti-Estrogen Receptor Antibody-Oligo Conjugate (ARC67956)
SKU: aoc2011
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Estrogen Receptor Antibody (ARC67956)-IF1
Antibody Target
- Target
- Estrogen receptor beta
- UniProt Number
- Q92731
- Target Description
- Nuclear hormone receptor. Binds estrogens with an affinity similar to that of ESR1/ER-alpha, and activates expression of reporter genes containing estrogen response elements (ERE) in an estrogen-dependent manner.; FUNCTION: [Isoform 2]: Lacks ligand binding ability and has no or only very low ERE binding activity resulting in the loss of ligand-dependent transactivation ability.
- Molecular Weight
- 59kDa/54kDa/35kDa/48kDa/42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC67956
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat