Antibodies
Anti-ETV1 Antibody-Oligo Conjugate
SKU: aoc2014
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-ETV1 Antibody-PLA1
Antibody Target
- Target
- ETS translocation variant 1
- UniProt Number
- P50549
- Target Description
- Transcriptional activator that binds to DNA sequences containing the consensus pentanucleotide 5'-CGGA[AT]-3'. Required for olfactory dopaminergic neuron differentiation; may directly activate expression of tyrosine hydroxylase (TH).
- Molecular Weight
- 55 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISAChIP
- Clone
- ARC60301
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat