Antibodies
Anti-Exportin 5 (XPO5) Antibody-Oligo Conjugate
SKU: aoc2021
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Exportin 5 (XPO5) Antibody-IF1
Antibody Target
- Target
- Exportin-5
- UniProt Number
- Q9HAV4
- Target Description
- Mediates the nuclear export of proteins bearing a double-stranded RNA binding domain (dsRBD) and double-stranded RNAs (cargos). XPO5 in the nucleus binds cooperatively to the RNA and to the GTPase Ran in its active GTP-bound form. Proteins containing dsRBDs can associate with this trimeric complex through the RNA. Docking of this complex to the nuclear pore complex (NPC) is mediated through binding to nucleoporins. Upon transit of a nuclear export complex into the cytoplasm, hydrolysis of Ran-GTP to Ran-GDP (induced by RANBP1 and RANGAP1, respectively) cause disassembly of the complex and release of the cargo from the export receptor. XPO5 then returns to the nuclear compartment by diffusion through the nuclear pore complex, to mediate another round of transport. The directionality of nuclear export is thought to be conferred by an asymmetric distribution of the GTP- and GDP-bound forms of Ran between the cytoplasm and nucleus. Overexpression may in some circumstances enhance RNA-mediated gene silencing (RNAi). Mediates nuclear export of isoform 5 of ADAR/ADAR1 in a RanGTP-dependent manner.; FUNCTION: Mediates the nuclear export of micro-RNA precursors, which form short hairpins. Also mediates the nuclear export of synthetic short hairpin RNAs used for RNA interference. In some circumstances can also mediate the nuclear export of deacylated and aminoacylated tRNAs. Specifically recognizes dsRNAs that lack a 5'-overhang in a sequence-independent manner, have only a short 3'-overhang, and that have a double-stranded length of at least 15 base-pairs. Binding is dependent on Ran-GTP.; FUNCTION: (Microbial infection) Mediates the nuclear export of adenovirus VA1 dsRNA.
- Molecular Weight
- 136kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0838
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat