Antibodies
Anti-EXT1 Antibody-Oligo Conjugate
SKU: aoc2022
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EXT1 Antibody-IF1
Antibody Target
- Target
- Exostosin-1
- UniProt Number
- Q16394
- Target Description
- Glycosyltransferase forming with EXT2 the heterodimeric heparan sulfate polymerase which catalyzes the elongation of the heparan sulfate glycan backbone. Glycan backbone extension consists in the alternating transfer of (1->4)-beta-D-GlcA and (1->4)-alpha-D-GlcNAc residues from their respective UDP-sugar donors. Both EXT1 and EXT2 are required for the full activity of the polymerase since EXT1 bears the N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity within the complex while EXT2 carries the glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity. Heparan sulfate proteoglycans are ubiquitous components of the extracellular matrix and play an important role in tissue homeostasis and signaling.
- Molecular Weight
- 86 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC78494
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat