Antibodies
Anti-Ezrin Antibody-Oligo Conjugate
SKU: aoc2023
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Ezrin Antibody-IF1
Antibody Target
- Target
- Ezrin
- UniProt Number
- P15311
- Target Description
- Probably involved in connections of major cytoskeletal structures to the plasma membrane. In epithelial cells, required for the formation of microvilli and membrane ruffles on the apical pole. Along with PLEKHG6, required for normal macropinocytosis..
- Molecular Weight
- 69kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0392
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human