Antibodies
Anti-FABP5 Antibody-Oligo Conjugate
SKU: aoc2028
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FABP5 Antibody-IF1
Antibody Target
- Target
- Fatty acid-binding protein 5
- UniProt Number
- Q01469
- Target Description
- Intracellular carrier for long-chain fatty acids and related active lipids, such as endocannabinoids, that regulate the metabolism and actions of the ligands they bind. In addition to the cytosolic transport, selectively delivers specific fatty acids from the cytosol to the nucleus, wherein they activate nuclear receptors (PubMed:21395585, PubMed:22170058). Delivers retinoic acid to the nuclear receptor peroxisome proliferator-activated receptor delta; which promotes proliferation and survival. May also serve as a synaptic carrier of endocannabinoid at central synapses and thus controls retrograde endocannabinoid signaling. Modulates inflammation by regulating PTGES induction via NF-kappa-B activation, and prostaglandin E2 (PGE2) biosynthesis during inflammation (By similarity). May be involved in keratinocyte differentiation (PubMed:8092987)..
- Molecular Weight
- 15kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC72917
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat