Antibodies
Anti-FABPI Antibody-Oligo Conjugate
SKU: aoc2030
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FABPI Antibody-IF1
Antibody Target
- Target
- Fatty acid-binding protein, intestinal
- UniProt Number
- P12104
- Target Description
- FABPs are thought to play a role in the intracellular transport of long-chain fatty acids and their acyl-CoA esters. FABP2 is probably involved in triglyceride-rich lipoprotein synthesis. Binds saturated long-chain fatty acids with a high affinity, but binds with a lower affinity to unsaturated long-chain fatty acids. FABP2 may also help maintain energy homeostasis by functioning as a lipid sensor.
- Molecular Weight
- 15kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC1343
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat