Antibodies
Anti-FANCD2 Antibody-Oligo Conjugate
SKU: aoc2039
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-FANCD2 Antibody-PLA1
Antibody Target
- Target
- Fanconi anemia group D2 protein
- UniProt Number
- Q9BXW9
- Target Description
- Required for maintenance of chromosomal stability (PubMed:11239453, PubMed:14517836). Promotes accurate and efficient pairing of homologs during meiosis (PubMed:14517836). Involved in the repair of DNA double-strand breaks, both by homologous recombination and single-strand annealing (PubMed:15671039, PubMed:15650050, PubMed:30335751, PubMed:36385258). The FANCI-FANCD2 complex binds and scans double-stranded DNA (dsDNA) for DNA damage; this complex stalls at DNA junctions between double-stranded DNA and single-stranded DNA (By similarity). May participate in S phase and G2 phase checkpoint activation upon DNA damage (PubMed:15377654). Plays a role in preventing breakage and loss of missegregating chromatin at the end of cell division, particularly after replication stress (PubMed:15454491, PubMed:15661754). Required for the targeting, or stabilization, of BLM to non-centromeric abnormal structures induced by replicative stress (PubMed:15661754, PubMed:19465921). Promotes BRCA2/FANCD1 loading onto damaged chromatin (PubMed:11239454, PubMed:12239151, PubMed:12086603, PubMed:15115758, PubMed:15199141, PubMed:15671039, PubMed:18212739). May also be involved in B-cell immunoglobulin isotype switching..
- Molecular Weight
- 164 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0172
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat