Antibodies
Anti-Fascin Antibody-Oligo Conjugate
SKU: aoc2041
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Fascin Antibody-IF1
Antibody Target
- Target
- Fascin
- UniProt Number
- Q16658
- Target Description
- Actin-binding protein that contains 2 major actin binding sites (PubMed:21685497, PubMed:23184945). Organizes filamentous actin into parallel bundles (PubMed:20393565, PubMed:21685497, PubMed:23184945). Plays a role in the organization of actin filament bundles and the formation of microspikes, membrane ruffles, and stress fibers (PubMed:22155786). Important for the formation of a diverse set of cell protrusions, such as filopodia, and for cell motility and migration (PubMed:20393565, PubMed:21685497, PubMed:23184945). Mediates reorganization of the actin cytoskeleton and axon growth cone collapse in response to NGF (PubMed:22155786)..
- Molecular Weight
- 55kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1638
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat