Antibodies
Anti-FATP2 Antibody-Oligo Conjugate
SKU: aoc2043
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FATP2 Antibody-IF1
Antibody Target
- Target
- Long-chain fatty acid transport protein 2
- UniProt Number
- O14975
- Target Description
- Mediates the import of long-chain fatty acids (LCFA) into the cell by facilitating their transport across cell membranes, playing an important role in hepatic fatty acid uptake (PubMed:10198260, PubMed:10749848, PubMed:11980911, PubMed:20530735, PubMed:22022213, PubMed:24269233). Also functions as an acyl-CoA ligase catalyzing the ATP-dependent formation of fatty acyl-CoA using LCFA and very-long-chain fatty acids (VLCFA) as substrates, which prevents fatty acid efflux from cells and might drive more fatty acid uptake (PubMed:10198260, PubMed:10749848, PubMed:11980911, PubMed:20530735, PubMed:22022213, PubMed:24269233). Plays a pivotal role in regulating available LCFA substrates from exogenous sources in tissues undergoing high levels of beta-oxidation or triglyceride synthesis (PubMed:20530735). Can also activate branched-chain fatty acids such as phytanic acid and pristanic acid (PubMed:10198260). May contribute to the synthesis of sphingosine-1-phosphate (PubMed:24269233). Does not activate C24 bile acids, cholate and chenodeoxycholate (PubMed:11980911). In vitro, activates 3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanate (THCA), the C27 precursor of cholic acid deriving from the de novo synthesis from cholesterol (PubMed:11980911). However, it is not critical for THCA activation and bile synthesis in vivo (PubMed:20530735)..; FUNCTION: [Isoform 1]: Exhibits both long-chain fatty acids (LCFA) transport activity and acyl CoA synthetase towards very long-chain fatty acids (PubMed:10198260, PubMed:21768100). Shows a preference for generating CoA derivatives of n-3 fatty acids, which are preferentially trafficked into phosphatidylinositol (PubMed:21768100)..; FUNCTION: [Isoform 2]: Exhibits long-chain fatty acids (LCFA) transport activity but lacks acyl CoA synthetase towards very long-chain fatty acids..
- Molecular Weight
- 70kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC65629
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat