Antibodies
Anti-FBP1 Antibody-Oligo Conjugate (ARC2693)
SKU: aoc2047
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FBP1 Antibody (ARC2693)-IF1
Antibody Target
- Target
- Fructose-1,6-bisphosphatase 1
- UniProt Number
- P09467
- Target Description
- Catalyzes the hydrolysis of fructose 1,6-bisphosphate to fructose 6-phosphate in the presence of divalent cations, acting as a rate-limiting enzyme in gluconeogenesis. Plays a role in regulating glucose sensing and insulin secretion of pancreatic beta-cells. Appears to modulate glycerol gluconeogenesis in liver. Important regulator of appetite and adiposity; increased expression of the protein in liver after nutrient excess increases circulating satiety hormones and reduces appetite-stimulating neuropeptides and thus seems to provide a feedback mechanism to limit weight gain.
- Molecular Weight
- 37kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2693
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat