Antibodies
Anti-FCRN Antibody-Oligo Conjugate
SKU: aoc2051
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FCRN Antibody-IF1
Antibody Target
- Target
- IgG receptor FcRn large subunit p51
- UniProt Number
- P55899
- Target Description
- Cell surface receptor that transfers passive humoral immunity from the mother to the newborn. Binds to the Fc region of monomeric immunoglobulin gamma and mediates its selective uptake from milk. IgG in the milk is bound at the apical surface of the intestinal epithelium. The resultant FcRn-IgG complexes are transcytosed across the intestinal epithelium and IgG is released from FcRn into blood or tissue fluids. Throughout life, contributes to effective humoral immunity by recycling IgG and extending its half-life in the circulation. Mechanistically, monomeric IgG binding to FcRn in acidic endosomes of endothelial and hematopoietic cells recycles IgG to the cell surface where it is released into the circulation. In addition of IgG, regulates homeostasis of the other most abundant circulating protein albumin/ALB.; FUNCTION: (Microbial infection) Acts as an uncoating receptor for a panel of echoviruses including Echovirus 5, 6, 7, 9, 11, 13, 25 and 29.
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC59051
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat