Antibodies
Anti-FDX1/ADX Antibody-Oligo Conjugate
SKU: aoc2055
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FDX1/ADX Antibody-IF1
Antibody Target
- Target
- Adrenodoxin, mitochondrial
- UniProt Number
- P10109
- Target Description
- Essential for the synthesis of various steroid hormones (PubMed:20547883, PubMed:21636783). Participates in the reduction of mitochondrial cytochrome P450 for steroidogenesis (PubMed:20547883, PubMed:21636783). Transfers electrons from adrenodoxin reductase to CYP11A1, a cytochrome P450 that catalyzes cholesterol side-chain cleavage (PubMed:20547883, PubMed:21636783). Does not form a ternary complex with adrenodoxin reductase and CYP11A1 but shuttles between the two enzymes to transfer electrons (By similarity)..
- Molecular Weight
- 19 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC2854
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat