Antibodies
Anti-FGF1 Antibody-Oligo Conjugate (ARC1414)
SKU: aoc2061
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FGF1 Antibody (ARC1414)-IF1
Antibody Target
- Target
- Fibroblast growth factor 1
- UniProt Number
- P05230
- Target Description
- Plays an important role in the regulation of cell survival, cell division, angiogenesis, cell differentiation and cell migration. Functions as a potent mitogen in vitro. Acts as a ligand for FGFR1 and integrins. Binds to FGFR1 in the presence of heparin leading to FGFR1 dimerization and activation via sequential autophosphorylation on tyrosine residues which act as docking sites for interacting proteins, leading to the activation of several signaling cascades. Binds to integrin ITGAV:ITGB3. Its binding to integrin, subsequent ternary complex formation with integrin and FGFR1, and the recruitment of PTPN11 to the complex are essential for FGF1 signaling. Induces the phosphorylation and activation of FGFR1, FRS2, MAPK3/ERK1, MAPK1/ERK2 and AKT1 (PubMed:18441324, PubMed:20422052). Can induce angiogenesis (PubMed:23469107)..
- Molecular Weight
- 17kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1414
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat