Antibodies
Anti-FGF2 Antibody-Oligo Conjugate (ARC0618)
SKU: aoc2062
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FGF2 Antibody (ARC0618)-IF1
Antibody Target
- Target
- Fibroblast growth factor 2
- UniProt Number
- P09038
- Target Description
- Acts as a ligand for FGFR1, FGFR2, FGFR3 and FGFR4. Also acts as an integrin ligand which is required for FGF2 signaling. Binds to integrin ITGAV:ITGB3. Plays an important role in the regulation of cell survival, cell division, cell differentiation and cell migration. Functions as a potent mitogen in vitro. Can induce angiogenesis. Mediates phosphorylation of ERK1/2 and thereby promotes retinal lens fiber differentiation.
- Molecular Weight
- 31kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0618
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human