Antibodies
Anti-FGF23 Antibody-Oligo Conjugate
SKU: aoc2065
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FGF23 Antibody-IF1
Antibody Target
- Target
- Fibroblast growth factor 23
- UniProt Number
- Q9GZV9
- Target Description
- Regulator of phosphate homeostasis (PubMed:11062477). Inhibits renal tubular phosphate transport by reducing SLC34A1 levels (PubMed:11409890). Up-regulates EGR1 expression in the presence of KL (By similarity). Acts directly on the parathyroid to decrease PTH secretion (By similarity). Regulator of vitamin-D metabolism (PubMed:15040831). Negatively regulates osteoblast differentiation and matrix mineralization (PubMed:18282132)..
- Molecular Weight
- 28kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC64764
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human