Antibodies
Anti-FGFR3 Antibody-Oligo Conjugate
SKU: aoc2066
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FGFR3 Antibody-IF1
Antibody Target
- Target
- Fibroblast growth factor receptor 3
- UniProt Number
- P22607
- Target Description
- Tyrosine-protein kinase that acts as a cell-surface receptor for fibroblast growth factors and plays an essential role in the regulation of cell proliferation, differentiation and apoptosis. Plays an essential role in the regulation of chondrocyte differentiation, proliferation and apoptosis, and is required for normal skeleton development. Regulates both osteogenesis and postnatal bone mineralization by osteoblasts. Promotes apoptosis in chondrocytes, but can also promote cancer cell proliferation. Required for normal development of the inner ear. Phosphorylates PLCG1, CBL and FRS2. Ligand binding leads to the activation of several signaling cascades. Activation of PLCG1 leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate. Phosphorylation of FRS2 triggers recruitment of GRB2, GAB1, PIK3R1 and SOS1, and mediates activation of RAS, MAPK1/ERK2, MAPK3/ERK1 and the MAP kinase signaling pathway, as well as of the AKT1 signaling pathway. Plays a role in the regulation of vitamin D metabolism. Mutations that lead to constitutive kinase activation or impair normal FGFR3 maturation, internalization and degradation lead to aberrant signaling. Over-expressed or constitutively activated FGFR3 promotes activation of PTPN11/SHP2, STAT1, STAT5A and STAT5B. Secreted isoform 3 retains its capacity to bind FGF1 and FGF2 and hence may interfere with FGF signaling..
- Molecular Weight
- 88kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCELISA
- Clone
- ARC0398
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human