Antibodies
Anti-Fibrillarin Antibody-Oligo Conjugate (ARC0506)
SKU: aoc2073
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Fibrillarin Antibody (ARC0506)-IF1
Antibody Target
- Target
- rRNA 2'-O-methyltransferase fibrillarin
- UniProt Number
- P22087
- Target Description
- S-adenosyl-L-methionine-dependent methyltransferase that has the ability to methylate both RNAs and proteins (PubMed:24352239, PubMed:30540930, PubMed:32017898). Involved in pre-rRNA processing by catalyzing the site-specific 2'-hydroxyl methylation of ribose moieties in pre-ribosomal RNA (PubMed:30540930). Site specificity is provided by a guide RNA that base pairs with the substrate (By similarity). Methylation occurs at a characteristic distance from the sequence involved in base pairing with the guide RNA (By similarity). Probably catalyzes 2'-O-methylation of U6 snRNAs in box C/D RNP complexes (PubMed:32017898). U6 snRNA 2'-O-methylation is required for mRNA splicing fidelity (PubMed:32017898). Also acts as a protein methyltransferase by mediating methylation of 'Gln-105' of histone H2A (H2AQ104me), a modification that impairs binding of the FACT complex and is specifically present at 35S ribosomal DNA locus (PubMed:24352239, PubMed:30540930). Part of the small subunit (SSU) processome, first precursor of the small eukaryotic ribosomal subunit. During the assembly of the SSU processome in the nucleolus, many ribosome biogenesis factors, an RNA chaperone and ribosomal proteins associate with the nascent pre-rRNA and work in concert to generate RNA folding, modifications, rearrangements and cleavage as well as targeted degradation of pre-ribosomal RNA by the RNA exosome (PubMed:34516797)..
- Molecular Weight
- 34kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC0506
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat