Antibodies
Anti-Fibrinogen alpha chain Antibody-Oligo Conjugate
SKU: aoc2074
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Fibrinogen alpha chain Antibody-IF1
Antibody Target
- Target
- Fibrinogen alpha chain [Cleaved into: Fibrinopeptide A; Fibrinogen alpha chain]
- UniProt Number
- P02671
- Target Description
- Cleaved by the protease thrombin to yield monomers which, together with fibrinogen beta (FGB) and fibrinogen gamma (FGG), polymerize to form an insoluble fibrin matrix. Fibrin has a major function in hemostasis as one of the primary components of blood clots. In addition, functions during the early stages of wound repair to stabilize the lesion and guide cell migration during re-epithelialization. Was originally thought to be essential for platelet aggregation, based on in vitro studies using anticoagulated blood. However, subsequent studies have shown that it is not absolutely required for thrombus formation in vivo. Enhances expression of SELP in activated platelets via an ITGB3-dependent pathway. Maternal fibrinogen is essential for successful pregnancy. Fibrin deposition is also associated with infection, where it protects against IFNG-mediated hemorrhage. May also facilitate the immune response via both innate and T-cell mediated pathways..
- Molecular Weight
- 95kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2227
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Rat