Antibodies
Anti-Fibronectin Antibody-Oligo Conjugate (ARC2692)
SKU: aoc2075
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Fibronectin Antibody (ARC2692)-IF1
Antibody Target
- Target
- Fibronectin
- UniProt Number
- P02751
- Target Description
- Fibronectins bind cell surfaces and various compounds including collagen, fibrin, heparin, DNA, and actin (PubMed:3024962, PubMed:3593230, PubMed:3900070, PubMed:7989369). Fibronectins are involved in cell adhesion, cell motility, opsonization, wound healing, and maintenance of cell shape (PubMed:3024962, PubMed:3593230, PubMed:3900070, PubMed:7989369). Involved in osteoblast compaction through the fibronectin fibrillogenesis cell-mediated matrix assembly process, essential for osteoblast mineralization (By similarity). Participates in the regulation of type I collagen deposition by osteoblasts (By similarity). Acts as a ligand for the LILRB4 receptor, inhibiting FCGR1A/CD64-mediated monocyte activation (PubMed:34089617)..; FUNCTION: [Anastellin]: Binds fibronectin and induces fibril formation. This fibronectin polymer, named superfibronectin, exhibits enhanced adhesive properties. Both anastellin and superfibronectin inhibit tumor growth, angiogenesis and metastasis. Anastellin activates p38 MAPK and inhibits lysophospholipid signaling..; FUNCTION: Secreted by contracting muscle, induces liver autophagy, a degradative pathway for nutrient mobilization and damage removal, and systemic insulin sensitization via hepatic ITGA5:ITGB1 integrin receptor signaling..
- Molecular Weight
- 272kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2692
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse