Antibodies
Anti-FKBP38/FKBP8 Antibody-Oligo Conjugate
SKU: aoc2081
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FKBP38/FKBP8 Antibody-IF1
Antibody Target
- Target
- Peptidyl-prolyl cis-trans isomerase FKBP8
- UniProt Number
- Q14318
- Target Description
- Constitutively inactive PPiase, which becomes active when bound to calmodulin and calcium. Seems to act as a chaperone for BCL2, targets it to the mitochondria and modulates its phosphorylation state. The BCL2/FKBP8/calmodulin/calcium complex probably interferes with the binding of BCL2 to its targets. The active form of FKBP8 may therefore play a role in the regulation of apoptosis. Involved in the inhibition of viral infection by influenza A viruses (IAV).
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1259
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat