Antibodies
Anti-FKBP51 Antibody-Oligo Conjugate
SKU: aoc2082
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FKBP51 Antibody-IF1
Antibody Target
- Target
- Peptidyl-prolyl cis-trans isomerase FKBP5
- UniProt Number
- Q13451
- Target Description
- Immunophilin protein with PPIase and co-chaperone activities. Component of unligated steroid receptors heterocomplexes through interaction with heat-shock protein 90 (HSP90). Plays a role in the intracellular trafficking of heterooligomeric forms of steroid hormone receptors maintaining the complex into the cytoplasm when unliganded. Acts as a regulator of Akt/AKT1 activity by promoting the interaction between Akt/AKT1 and PHLPP1, thereby enhancing dephosphorylation and subsequent activation of Akt/AKT1. Interacts with IKBKE and IKBKB which facilitates IKK complex assembly leading to increased IKBKE and IKBKB kinase activity, NF-kappa-B activation, and IFN production.
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1858
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat