Antibodies
Anti-FKBP52/FKBP4 Antibody-Oligo Conjugate
SKU: aoc2083
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FKBP52/FKBP4 Antibody-IF1
Antibody Target
- Target
- Peptidyl-prolyl cis-trans isomerase FKBP4
- UniProt Number
- Q02790
- Target Description
- Immunophilin protein with PPIase and co-chaperone activities. Component of steroid receptors heterocomplexes through interaction with heat-shock protein 90 (HSP90). May play a role in the intracellular trafficking of heterooligomeric forms of steroid hormone receptors between cytoplasm and nuclear compartments. The isomerase activity controls neuronal growth cones via regulation of TRPC1 channel opening. Also acts as a regulator of microtubule dynamics by inhibiting MAPT/TAU ability to promote microtubule assembly. May have a protective role against oxidative stress in mitochondria..
- Molecular Weight
- 52kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0977
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat