Antibodies
Anti-FosB Antibody-Oligo Conjugate
SKU: aoc2093
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FosB Antibody-IF1
Antibody Target
- Target
- Protein FosB
- UniProt Number
- P53539
- Target Description
- Heterodimerizes with proteins of the JUN family to form an AP-1 transcription factor complex, thereby enhancing their DNA binding activity to gene promoters containing an AP-1 consensus sequence 5'-TGA[GC]TCA-3' and enhancing their transcriptional activity. As part of the AP-1 complex, facilitates enhancer selection together with cell-type-specific transcription factors by collaboratively binding to nucleosomal enhancers and recruiting the SWI/SNF (BAF) chromatin remodeling complex to establish accessible chromatin. Together with JUN, plays a role in activation-induced cell death of T cells by binding to the AP-1 promoter site of FASLG/CD95L, and inducing its transcription in response to activation of the TCR/CD3 signaling pathway. Exhibits transactivation activity in vitro. Involved in the display of nurturing behavior towards newborns. May play a role in neurogenesis in the hippocampus and in learning and memory-related tasks by regulating the expression of various genes involved in neurogenesis, depression and epilepsy. Implicated in behavioral responses related to morphine reward and spatial memory.; FUNCTION: [Isoform 11]: Exhibits lower transactivation activity than isoform 1 in vitro. The heterodimer with JUN does not display any transcriptional activity, and may thereby act as an transcriptional inhibitor. May be involved in the regulation of neurogenesis in the hippocampus. May play a role in synaptic modifications in nucleus accumbens medium spiny neurons and thereby play a role in adaptive and pathological reward-dependent learning, including maladaptive responses involved in drug addiction. Seems to be more stably expressed with a half-life of ~9.5 hours in cell culture as compared to 1.5 hours half-life of isoform 1.
- Molecular Weight
- 36kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC61057
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human