Antibodies
Anti-FOXA2 Antibody-Oligo Conjugate
SKU: aoc2094
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FOXA2 Antibody-IF1
Antibody Target
- Target
- Hepatocyte nuclear factor 3-beta
- UniProt Number
- Q9Y261
- Target Description
- Transcription factor that is involved in embryonic development, establishment of tissue-specific gene expression and regulation of gene expression in differentiated tissues. Is thought to act as a 'pioneer' factor opening the compacted chromatin for other proteins through interactions with nucleosomal core histones and thereby replacing linker histones at target enhancer and/or promoter sites. Binds DNA with the consensus sequence 5'-[AC]A[AT]T[AG]TT[GT][AG][CT]T[CT]-3' (By similarity). In embryonic development is required for notochord formation. Involved in the development of multiple endoderm-derived organ systems such as the liver, pancreas and lungs; FOXA1 and FOXA2 seem to have at least in part redundant roles. Originally described as a transcription activator for a number of liver genes such as AFP, albumin, tyrosine aminotransferase, PEPCK, etc. Interacts with the cis-acting regulatory regions of these genes. Involved in glucose homeostasis; regulates the expression of genes important for glucose sensing in pancreatic beta-cells and glucose homeostasis. Involved in regulation of fat metabolism. Binds to fibrinogen beta promoter and is involved in IL6-induced fibrinogen beta transcriptional activation..
- Molecular Weight
- 48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC0391
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human