Antibodies
Anti-FOXK1 Antibody-Oligo Conjugate
SKU: aoc2096
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FOXK1 Antibody-IF1
Antibody Target
- Target
- Forkhead box protein K1
- UniProt Number
- P85037
- Target Description
- Transcriptional regulator involved in different processes such as glucose metabolism, aerobic glycolysis, muscle cell differentiation and autophagy (By similarity). Recognizes and binds the forkhead DNA sequence motif (5'-GTAAACA-3') and can both act as a transcription activator or repressor, depending on the context (PubMed:17670796). Together with FOXK2, acts as a key regulator of metabolic reprogramming towards aerobic glycolysis, a process in which glucose is converted to lactate in the presence of oxygen (By similarity). Acts by promoting expression of enzymes for glycolysis (such as hexokinase-2 (HK2), phosphofructokinase, pyruvate kinase (PKLR) and lactate dehydrogenase), while suppressing further oxidation of pyruvate in the mitochondria by up-regulating pyruvate dehydrogenase kinases PDK1 and PDK4 (By similarity). Probably plays a role in gluconeogenesis during overnight fasting, when lactate from white adipose tissue and muscle is the main substrate (By similarity). Involved in mTORC1-mediated metabolic reprogramming: in response to mTORC1 signaling, translocates into the nucleus and regulates the expression of genes associated with glycolysis and downstream anabolic pathways, such as HIF1A, thereby regulating glucose metabolism (By similarity). Together with FOXK2, acts as a negative regulator of autophagy in skeletal muscle: in response to starvation, enters the nucleus, binds the promoters of autophagy genes and represses their expression, preventing proteolysis of skeletal muscle proteins (By similarity). Acts as a transcriptional regulator of the myogenic progenitor cell population in skeletal muscle (By similarity). Binds to the upstream enhancer region (CCAC box) of myoglobin (MB) gene, regulating the myogenic progenitor cell population (By similarity). Promotes muscle progenitor cell proliferation by repressing the transcriptional activity of FOXO4, thereby inhibiting myogenic differentiation (By similarity). Involved in remodeling processes of adult muscles that occur in response to physiological stimuli (By similarity). Required to correct temporal orchestration of molecular and cellular events necessary for muscle repair (By similarity). Represses myogenic differentiation by inhibiting MEFC activity (By similarity). Positively regulates Wnt/beta-catenin signaling by translocating DVL into the nucleus (PubMed:25805136). Reduces virus replication, probably by binding the interferon stimulated response element (ISRE) to promote antiviral gene expression (PubMed:25852164). Accessory component of the polycomb repressive deubiquitinase (PR-DUB) complex; recruits the PR-DUB complex to specific FOXK1-bound genes (PubMed:24634419, PubMed:30664650)..
- Molecular Weight
- 75kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIHCChIPELISA
- Clone
- ARC73739
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse